
Am J Psychiatry 159:1174-1182, July 2002
© 2002 American Psychiatric Association
Expression of Oct-6, a POU III Domain Transcription Factor, in Schizophrenia
Maria Ilia, B.Sc., Ph.D.,
Clare Beasley, B.Sc., Ph.D.,
Dies Meijer, Ph.D.,
Robert Kerwin, D.Sc., Ph.D.,
David Cotter, Ph.D., M.R.C.Psych.,
Ian Everall, Ph.D., M.R.C.Psych., and
Jack Price, B.A., Ph.D.

|
Abstract
|
OBJECTIVE: Oct-6, a POU-III domain transcription factor, is expressed in embryonic stem cells and Schwann cells and in neuronal subpopulations during early mammalian development, but its relevance to disorders of cerebral development in humans is untested. This study evaluated the expression of Oct-6 in schizophrenia, a disorder that has been linked with neurodevelopmental abnormalities. METHOD: Immunohistochemistry was used to examine Oct-6 expression in the temporal lobe in postmortem tissue from 10 subjects with schizophrenia and 10 matched comparison subjects. Western blot analysis was used to study Oct-6 expression in the frontal and temporal cortex in tissue from an additional three schizophrenic and three matched comparison subjects and in the frontal lobe only in tissue from an additional 10 schizophrenic and 10 matched comparison subjects. RESULTS: Extensive Oct-6 immunoreactivity was present in the temporal lobe in all 10 schizophrenic subjects, while very little or no expression was found in the comparison subjects. In schizophrenic subjects, Oct-6 immunoreactivity was found in a subset of cells in the pyramidal cell layer of the hippocampus and in the granule cell layer of the dentate gyrus. Oct-6 staining was predominantly localized in the cytoplasm. Western blot analysis confirmed the presence of Oct-6 in the frontal and temporal cortex in schizophrenic subjects but not in comparison subjects. CONCLUSIONS: The presence of Oct-6 expression in the schizophrenic subjects but not in the comparison subjects suggests that Oct-6 may provide a marker for the neuropathology associated with schizophrenia. Further, it may provide a clue to the neurodevelopmental basis of the disease and could be a reliable means to examine the developmental brain abnormalities described in this disorder.

|
Introduction
|
Schizophrenia is a brain disease whose etiology is largely unknown, but one current hypothesis is that the origins of the disorder lie early in life, possibly during prenatal brain development (1). This "neurodevelopmental hypothesis" suggests that a brain abnormality is present early in life but does not fully manifest itself clinically until late adolescence or early adulthood (2). This hypothesis has grown from studies of the neuropathology and epidemiology of the disease and has been supported by more recent imaging studies. These latter studies have demonstrated an enlargement of the cerebral ventricles in schizophrenic patients as well as structural abnormalities in the frontal and temporal lobes (3). These findings agree, in general, with neuropathological reports of temporal and frontal lobe abnormalities of the schizophrenic brain. Pathological studies also indicate that subtle abnormalities of cortical development may be present (4, 5). The findings of cytoarchitectural abnormalities, along with a lack of gliosis (6), have been taken as evidence that schizophrenia is a developmental disorder. Nonetheless, the pathological findings have been distinguished mostly by their variability and by the subtlety of the changes observed in schizophrenic patients in the markers that have been described. While the developmental processes implicated by this evidence have yet to be defined, speculation has centered on abnormalities of neuronal proliferation and migration and abnormalities of the formation of neuronal connections. There is little understanding, however, of the mechanism by which normal brain development might be disturbed.
Our approach to understanding schizophrenia pathology has been to consider the genes that regulate normal brain development. One such group of genes is the POU family of homeobox transcription factors. Members of this family are expressed in the nervous systems of a wide range of vertebrate and invertebrate species (710). We have studied expression of the Oct-6 gene (also known as SCIP and Tst-1), a POU-III subfamily member (11). Oct-6 also appears to have a predominantly developmental role, being expressed in embryonic stem cells and in the mouse inner cell mass (8, 12), but its best characterized role is in Schwann cell development in the peripheral nervous system, where it regulates the timely onset of myelination (13, 14).
In the developing rodent telencephalon, Oct-6 expression is turned on as neurons become postmitotic and migrate to their final positions in the cortical plate, the embryonic cortical gray matter (15). This means that Oct-6 is expressed during the period in which neurons first begin to establish their neuronal identity and axonal projection and in which they find their definitive cortical layer. In the postnatal brain, Oct-6 expression is mostly lost, but it is retained by certain specific subpopulations of neurons in layers 5 and 2/3 of the cerebral cortex and in the CA1 field of the hippocampus (15). The role of Oct-6 in neuronal development is unknown, but the timing of its expression suggests that it may play a role in establishing neuronal subtype identity and pattern of axonal projection.
In this study, we examined the pattern of expression of Oct-6 by studying immunoreactivity to the Oct-6 protein in the cortex of schizophrenic patients. We show that Oct-6 is widely expressed in the temporal and frontal lobe of schizophrenic specimens, while it is essentially undetectable in matched comparison specimens.

|
Method
|
Human Tissue
Samples were obtained from the Medical Research Council Brain Bank, Institute of Psychiatry, Kings College London. Demographic characteristics of the schizophrenic subjects and the comparison subjects are described in Table 1, Table 2, and Table 3. There were no significant differences in age, gender, or postmortem interval between groups. Exclusion criteria included any disorders related to the central nervous system, such as head injury, alcohol dependence, or Alzheimers disease. Tissue was obtained from patients with a clinical diagnosis of schizophrenia according to DSM-III-R criteria. The mean amount of neuroleptic exposure in the month before death was estimated for the schizophrenic subjects (Table 1 and Table 2) and expressed in chlorpromazine equivalents. There was no information on chlorpromazine equivalents values for the 10 schizophrenic specimens presented in Table 3.
Oct-6 Antiserum Generation
To obtain antibodies specific to Oct-6, we immunized rabbits with bacterially overexpressed and purified Oct-61196 protein (12). For expression in bacteria of the amino-terminal portion (amino acids 1 through 196) of the Oct-6 protein, we cloned a 587 BalI-PvuII restriction fragment in frame into the pQE9 bacterial expression cassette (Qiagen, Crawley, U.K.). This allowed the use of isopropyl-beta-D-thiogalactopyranoside (IPTG) to induce overexpression of the hexa-histidine (His6)-tagged Oct-61196 peptide in bacteria (M15[prep4]) (Qiagen) from an E. coli phage T5 promoter. Briefly, an overnight bacterial culture was pelleted and sonicated in 10 ml of 6M urea in phosphate-buffered solution (PBS). The cell lysate was cleared by centrifugation and brought to 0.8 mM imidazole, after which 300 µl of slurry nickel-nitrilotriacetate (Ni-NTA) agarose beads (Qiagen) was added. The His6-tagged Oct-6 peptide was allowed to bind to the Ni-NTA beads by incubating the mixture of lysate and Ni-NTA slurry overnight. The Oct-6 peptide was eluted from the Ni-NTA beads in 500µl of 6M urea in the mixture of PBS and 80 mM imidazole. This purification procedure resulted in high yields of pure (>95%) and intact Oct-61196 peptide, as judged by Coomassie-stained sodium dodecyl sulfate polyacrylamide gels. Antibodies were raised in White New Zealand rabbits with four consecutive injections at 4-week intervals of 0.51.0 mg Oct-61169 peptide resuspended in incomplete Freunds adjuvant. Oct-6 immunoreactivity and specificity of the sera (number 1894, boost 4) were tested in Western blotting, immunohistochemistry, and electrophoretic mobility shift experiments.
COS Cell Transfection
COS-1 cells were grown in Dulbeccos modified Eagles medium or Hams F10 medium supplemented with 5% fetal calf serum, penicillin, and streptomycin. Cells were transfected by using the diethylaminoethyl (DEAE)-dextran method (16). The day preceding transfection 500,000 cells were plated on a 10-cm tissue culture dish. The next day the cells were transfected with 10 µg of plasmid DNA (cytomegalovirus-Oct-6 or cytomegalovirus-Krox-20 expression vectors) and 100 µg/ml of DEAE-dextran (Amersham Pharmacia Biotech, Little Chalfont, U.K.). After 2 hours the transfection medium was removed and replaced by a serum-free medium containing 0.1 mM of chloroquine (Sigma, St. Louis). Two days later cells were harvested and further processed for electrophoretic mobility shift assay and Western blotting analysis (12).
Whole-Cell Extracts and Electrophoretic Mobility Shift Assay
Whole-cell extracts of adenovirus-12-E1A-transformed mouse kidney cells were prepared by subjecting the cells to four cycles of freezing in liquid nitrogen and thawing on ice. The cellular debris was removed by centrifugation, and the supernatant was snap-frozen in liquid nitrogen and stored at 80°C or used immediately. Equal amounts of cellular extract were used in an electrophoretic mobility shift assay by using 3 fmol of a 32P end-labeled double stranded DNA probe (GAGAGGAATTTGCATTTCCACCGACCTTCC). Probe and protein were incubated on ice for 20 minutes in 20 mM of Hepes potassium hydroxide (pH 7.9), 1 mM EDTA, 1 mM ethylene glycol bis(beta-aminoethyl ether)-NN'-tetraacetic acid, and 4% Ficoll in a total volume of 20 ml. These incubations were done in the presence of 1 µl of crude Oct-6, Brn-1, or preimmune serum. Protein DNA complexes were separated on a native 4% polyacrylamide gel in 0.25 x Tris-borate buffer and visualized by exposure to an X-ray film.
Tissue Processing and Immunohistochemistry
Blocks of temporal lobe were taken at the level of the lateral geniculate body and included the parahippocampal gyrus and hippocampus. All blocks used for immunohistochemistry were fixed in 10% formalin and subsequently coronally sliced before being embedded in paraffin wax. Seven-µm thick sections were stained by using standard immunohistochemical procedures to reveal the presence and location of Oct-6. Briefly, sections were dewaxed, rehydrated in methanol, and pretreated with 1% H2O2 for 30 minutes. Sections were then microwaved at 800 W for 8 minutes in a 0.001% solution of citric acid and phosphate buffer (pH 6.0). After being subjected to extensive washes with Tris-buffered saline, the sections were blocked with normal swine serum (Dako, Ltd., Ely, U.K.) and then incubated in the primary rabbit polyclonal anti-Oct-6 (1:250) antibody in Tris-buffered saline overnight at 4°C. The Oct-6 polyclonal antiserum used in this study was raised against the N-terminal region of Oct-6, a region of least homology with other POU proteins such as Oct-1, Oct-3, Oct-4, Brn-1, Brn-3, and Brn-4 (17). The coding sequence of the Oct-6 gene has 99% identity between the human (18), mouse (8, 12), and rat sequences (7, 19). Therefore, the antibody can be used to detect human Oct-6 protein in immunohistochemical applications. Finally a three-step avidin-biotin-horseradish peroxidase complex system was used (Dako, Ltd.), and the antibody was visualized by using the chromogen diaminobenzidine (Vector, Peterborough, U.K.). Duplicate sections of adjacent tissue in which the primary antibody was replaced by Tris-buffered saline were processed in parallel and were used as negative comparison tissue. All sections were analyzed with a Nikon light microscope with image analysis software (Lucia 4.0) (Kingston Upon Thames, U.K.).
Western Blot Analysis
Protein extracts were prepared from the temporal and frontal lobes of three schizophrenic and three comparison subjects. Protein samples were also extracted from the frontal lobe of 10 additional schizophrenic specimens and 10 additional matched comparison specimens. Each extract was lysed by the addition of 1% Nonidet P-40 lysis buffer plus protease inhibitors (2 µg of pepstatin per ml, 2 µg of leupeptin per ml, and 1 µg of peprotonin per ml) and vortexing. Solubilized samples were then centrifuged at 13,000 rpm at 4°C for 10 minutes. The protein concentration from each extract was estimated by performing a DC protein assay (Bio-Rad, Hemel Hempstead, U.K.). The solubilized lysates were then diluted to allow 2 µg (for Oct-6) and 0.5 µg (for ß-catenin) of total protein to be loaded per lane. Optimization experiments showed that these amounts were within the linear range of detection. After protein quantification, samples were solubilized in standard sodium dodecyl sulfate sample buffer, denatured, and run on 10% Tris-polyacrylamide gels (Bio-Rad). The proteins were then transferred to 0.2 µm nitrocellulose paper (Sigma) by using a semidry blotting apparatus (Bio-Rad) and run at 10 V for 30 minutes. The blots were blocked with 10% casein solution (Sigma) for 30 minutes, and they were then treated with the avidin-biotin complex method according to the manufacturers instructions (Sigma). Next the membranes were incubated with either primary polyclonal antibody against Oct-6 (1:3,500) or a mouse polyclonal against ß-catenin (1:10,000) (BD Biosciences Transduction Labs, Lexington, Kent.) for 30 minutes. Blots were then incubated with secondary biotinylated goat antirabbit antibody (Vector) for 30 minutes. Finally, a Vectastain ABC complex system (Vector) was used, and the blots were treated with the chromogen diaminobenzidine (Vector) until bands could be clearly seen. Negative comparison blots consisted of duplicate blots that were processed in parallel in which the primary antibody was replaced by Tris-buffered saline-T.

|
Results
|
Antibody Specificity
A polyclonal antiserum was raised in rabbits against the amino-terminal portion (amino acids 2 through 196) of the mouse Oct-6 protein, which is 98% identical to the Oct-6 proteins in the rat and in humans (7, 18, 19). This sequence was chosen because it is unique to Oct-6 and is not shared even by related POU-III domain proteins. The specificity of the antibody was demonstrated in three ways. First, the Oct-6 antibody specifically recognized a 45-kDa band in whole-cell extracts of COS cells transfected with an Oct-6 expression cassette (Figure 1, top part), while no such band was detected in whole-cell extracts of COS cells transfected with an expression cassette for Krox-20, an unrelated transcription factor (column 2 in the top part of Figure 1). Thus, cells engineered to carry the Oct-6 gene express a protein that specifically reacts with the anti-Oct-6 antibody. Second, specificity was demonstrated in an electrophoretic mobility shift assay. In this assay, mouse kidney cells transformed by the adenovirus E1A region expressed three POU proteins that bind with high affinity to the octamer sequence ATTTGCAT (20). These proteins are Oct-1, Oct-6, and Brn-1 (Figure 1, bottom part). Addition of Oct-6 polyclonal antiserum abolished the formation of an Oct-6DNA complex but did not affect the formation of the Oct-1 and Brn-1DNA complexes in the same extract (Figure 1, bottom part). Similarly, a Brn-1-specific antibody only affects the Brn-1DNA complex and not the Oct-1 and Oct-6 complex (Figure 1, bottom part). Thus, the Oct-6 antiserum specifically binds the Oct-6 protein but not the closely related Brn-1 protein or the more distantly related Oct-1 protein. Third, the antibody specifically recognized a band of the appropriate molecular weight in Western blots of extracts of tissue in which Oct-6 is expressed. This specific band can be seen in sciatic nerve extracts of young mouse pups (Figure 1, top part) at a time in development when the expression of Oct-6 in Schwann cells of the developing peripheral nerve is well documented (13, 14, 2123).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 1. Results of Western Blot Analysis and Electrophoretic Mobility Shift Assay Showing the Reactions of Oct-6 Antibody to Oct-6 Protein and Related Proteinsa
aIn the top part of the figure, the Oct-6 antibody specifically recognizes a 45-kDa band in whole-cell extracts of COS cells transfected with an Oct-6 expression cassette (column 1), while no such band is detected in whole-cell extracts of COS cells transfected with a Krox-20 expression cassette (column 2). In addition, the antibody detects Oct-6 in sciatic nerve extracts of young mouse pups (postnatal day 8) (column 3). In the bottom part of the figure, addition of Oct-6 antibody abolishes the formation of the Oct-6DNA complex but not the formation of the Oct-1 and Brn-1DNA complexes in the same extract. Similarly, a Brn-1 antibody affects only the Brn-1DNA complex and not the Oct-1 and Oct-6 complexes.
|
Thus, we have defined the specificity of the anti-Oct-6 antibody by three criteria:
1. Cells transfected with Oct-6 cDNA react with a single protein of appropriate electrophoretic mobility, while control transfected cells do not.
2. Tissue expressing endogenous Oct-6 shows a similar immunoreactive protein by Western blot.
3. The antibody specifically blocks the binding of Oct-6 to its cognate octamer binding sequence.
Immunohistochemical Staining
We used the anti-Oct-6 antibody to stain sections of comparison brain immunohistochemically. Sections from the hippocampal region of 10 comparison subjects (Table 1) failed to show any staining (Figure 2, panel B). This region included the CA1 field of the hippocampus and layer V of the neocortex, areas where Oct-6 mRNA has been reported in young adult rodent brain. When we stained sections of the hippocampus from schizophrenic brains, however, we observed a considerable degree of Oct-6 immunoreactivity. Oct-6 was seen in a subset of cells in the pyramidal cell layer across the hippocampal formation, with no or very little staining in the adjoining strata oriens and radiatum (Figure 2, panels D and F). The morphology of these cells suggested that they were indeed pyramidal neurons. Staining was marginal in the CA1 field, with few cells showing Oct-6 immunoreactivity (data not shown), but in the CA2, CA3, and CA4 fields a clear subset of pyramidal neurons were immunoreactive (Figure 2, panels F, D, and C). Staining indicating Oct-6 immunoreactivity was also seen in a subset of neurons in the granule cell layer of the dentate gyrus (Figure 2, panel E). This Oct-6 staining was widely expressed in the hippocampus of all 10 schizophrenic specimens (Figure 2, panel C), in dramatic contrast with the comparison specimens (Figure 2, panel B).

View larger version (130K):
[in this window]
[in a new window]
|
Figure 2. Results of Immunohistochemical Study of Temporal Lobe Structures in Postmortem Brain Tissue From Subjects With Schizophrenia and Normal Comparison Subjectsa
aPanel A shows a Nissl-stained section of the hippocampal formation in a schizophrenic specimen. Oct-6 staining is present across the pyramidal layer of the hippocampus (indicated by arrows in panels D and F) and in the granule cell layer of the dentate gyrus (indicated by arrows in panel E). There was not much staining in the adjoining strata (oriens and radiatum) (panel F). High Oct-6 immunoreactivity is shown in the CA4 region of a schizophrenic specimen (indicated by arrows in panel C), while there is no or very little expression in the same region of a matched comparison specimen (panel B). Oct-6 staining is predominantly cytosolic (indicated by arrows in panel G).
|
Higher power microscopy revealed that the Oct-6 staining was predominantly localized in the cytoplasm of the pyramidal cells, with little evidence of nuclear staining (Figure 2, panel G). In the granule cell layer, cells appeared to be stained both in the cytoplasm and the nucleus (data not shown).
Western Blot Analysis
Protein levels of Oct-6 were examined in extracts from the frontal and temporal cortex of three schizophrenic and three matched comparison subjects. Immunoblots confirmed that the Oct-6 antibody recognized a single protein of about 45 kDa, as expected (8) (Figure 3). There were high levels of Oct-6 in the frontal and temporal lobe of the schizophrenic specimens, while there was no or very little Oct-6 expression in the same regions of the matched comparison specimens (Figure 3).

View larger version (59K):
[in this window]
[in a new window]
|
Figure 3. Results of Western Blot Analysis of Extracts From the Frontal and Temporal Lobes in Postmortem Brain Tissue From Subjects With Schizophrenia and Normal Comparison Subjectsa
aIn the top part of the figure, brain extracts from the frontal and temporal lobes of three schizophrenic subjects and three comparison subjects are compared with a polyclonal antiserum against Oct-6 and a mouse antiserum against ß-catenin. In the bottom part of the figure, brain extracts from the frontal lobe of an additional 10 schizophrenic subjects and 10 comparison subjects are compared with a polyclonal antiserum against Oct-6. Immunostaining of the blots revealed bands for Oct-6 at 45 kDa and for ß-catenin at 92 kDa. High levels of Oct-6 protein were expressed in both brain regions in the schizophrenic specimens, but no or little Oct-6 expression was found in similar brain regions of the comparison subjects. No marked differences were found in levels of ß-catenin expression between the schizophrenic and comparison specimens.
|
To ensure that there was no systematic error in the processing of the schizophrenic tissue versus the comparison tissue, Western blotting for ß-catenin, a protein previously linked with schizophrenia, was performed for the three schizophrenic and three comparison specimens described in the previous paragraph (24). Immunostaining of blots revealed bands for ß-catenin at 92 kDa in both the schizophrenic and the comparison groups (Figure 3).
To increase the number of schizophrenic specimens, we studied Oct-6 expression in samples from the frontal lobe from 10 additional schizophrenic subjects and 10 additional matched comparison subjects. Immunoblots revealed high levels of Oct-6 in the frontal lobe of eight of the 10 schizophrenic specimens, while there was no or very little Oct-6 expression in the matched comparison subjects (Figure 3).

|
Discussion
|
This study demonstrated that extensive Oct-6 immunoreactivity is present in the frontal and temporal lobes of schizophrenic specimens, while there is limited expression of Oct-6 in matched comparison specimens. That this immunoreactivity is genuinely related to Oct-6 was confirmed by three sets of findings. First, COS cells transfected with a full-length Oct-6 cDNA expressed a band that comigrates with the native band in the nervous system. Second, electrophoretic mobility shift assay indicated that the Oct-6 antibody reacts with the Oct-6 protein and not with the related proteins Oct-1 or Brn-1. Finally, Western blots indicated that in tissue expressing Oct-6, the antibody recognizes a single band with the expected electrophoretic mobility in protein gels. The specific band of apparent molecular weight of 45 kDa was observed in tissue from the frontal and temporal lobes of the three schizophrenic subjects included in the histochemical analysis for which fresh-frozen material was available, but not in tissue from three of the matched comparison subjects. Immunoreactivity for ß-catenin in all of these samples was similar. This protein has previously been shown to be expressed at similar levels in schizophrenic and comparison brains (25), so we take this finding as evidence that the difference in Oct-6 immunoreactivity between the schizophrenic and the comparison subjects could not be explained by trivial differences in the degree of protein deterioration between the samples. Oct-6 Western blot analysis was also performed on 10 additional schizophrenic and 10 additional comparison specimens for which fresh-frozen material was available. Eight of the ten schizophrenic specimens but none of the comparison specimens showed immunoreactivity. These data appear to indicate unequivocally that Oct-6 is expressed at greater levels in schizophrenic versus comparison brains. To our knowledge, this is the first reported example of a transcription factor being differentially expressed in schizophrenic versus comparison brains. We also believe this study reports the only example of a protein that is undetectable in comparison brains and is so demonstrably expressed in schizophrenic tissue. Other examples of differential expression have, of course, been demonstrated, but these have been relatively subtle quantitative changes (see reference 26 for discussion).
Our findings are significant in two regards. First, they indicate that Oct-6 may be useful as a neuropathological marker in schizophrenia. This disorder has been linked with numerous pathologies such as enlarged lateral ventricles and changes in the cellular architecture and circuitry in the frontal and temporal lobes of the cerebral cortex. Nonetheless, there is not yet any single pathophysiological marker that unequivocally distinguishes schizophrenic from normal tissue. Our data suggest that Oct-6 is worthy of further evaluation in this regard. Second, our findings might be a clue to the neurodevelopmental etiology of schizophrenia. In rodents, Oct-6 is broadly expressed only during development (as discussed later in this section). Assuming this is also true in humans, our data have two possible interpretations: either Oct-6 expression was never lost in individuals who were to go on to develop the disease or Oct-6 was subsequently up-regulated before or after the onset of the disease. These alternatives will be difficult to distinguish in human patients, but animal studies may be able to cast light on the factors that may prolong or reactivate Oct-6 expression and that may therefore have a role in the expression in schizophrenia. We know that in developing systems, Oct-6 is sensitive to factors that raise intracellular cAMP (27) and to estradiol (28), but these factors have no obvious link to schizophrenia.
A third possibility that needs to be considered is whether Oct-6 could be turned on in the schizophrenic subjects as a result of antipsychotic medication. Our evidence suggests that this is not the explanation. Chlorpromazine equivalents values in the month before death varied from 0 to 4000 across the schizophrenic group, yet we observed no difference in Oct-6 expression between schizophrenic subjects. This indicates that Oct-6 expression does not vary with exposure to neuroleptic treatment and suggests that medication is unlikely to be the cause of Oct-6 expression.
The predominant role of Oct-6 is believed to be developmental. It is expressed in embryonic stem cells and the mouse inner cell mass (8, 12). As development progresses, Oct-6 is expressed in the embryonic telencephalon, but it is down-regulated during early postnatal development so that expression in the young adult is maintained only in layer 5 and some supragranular neurons of the cerebral cortex and in the CA1 region of the hippocampus (15, 29). Our preliminary data indicate that expression continues to fall with age (unpublished observations) and becomes undetectable in older adult rodents as in the comparison human specimens in our study. Oct-6 is known to activate certain neurotransmitter receptors such as the nicotinic acetylcholine receptor subunit (30) and the acetylcholine 3 receptor (31). It is expressed during the phase of neuronal migration, fate determination, and axonal outgrowth. Nonetheless, the role of Oct-6 in neuronal development is poorly understood. Schizophrenia, on the other hand, has been linked with many developmental brain abnormalities such as faulty neuronal migration (32, 33), altered spatial neuronal arrangement (4, 34), and the absence of significant gliosis (33). It is plausible, therefore, that Oct-6 may play a role in the mechanism that is responsible for these developmental changes in schizophrenia.
Oct-6 staining was predominantly seen in the cytoplasm of neurons in the pyramidal cell layer of the hippocampus and in the dentate granule cell layer of the dentate gyrus. In the temporal lobe of schizophrenic specimens, Oct-6 staining was more prominent in the CA2, CA3, and CA4 regions and in the granule cell layer of the dentate gyrus than in the CA1 region. This finding suggests that Oct-6 may be associated with the changes in neuronal subpopulations and circuitry that are known to occur in schizophrenia. In support of this, it has been reported that MAP-2 (microtubule-associated protein) immunoreactive dendritic length is greater in the CA1, CA4, and subicular regions in schizophrenic specimens (35). This finding was based on the same schizophrenic samples as those used in the current study. The cytosolic localization of Oct-6 in schizophrenic brain is interesting because, under nonpathological conditions, Oct-6 is predominantly found in the nucleus, in line with its role as a transcription factor. Oct-6 is normally sequestered to the nucleus because of a nuclear localization sequence in the POU domain of the protein (36). Cytoplasmic Oct-6 could be the result of the breakdown of the nuclear transport or retention machinery in these cells. Alternatively Oct-6 protein could be sequestered in the cytoplasm through specific interactions with other proteins (37), as occurs with nuclear factor kappa B and glucocorticoid receptor transcription factors. These proteins are retained in the cytoplasm through complex formation with inhibitory kappa B or heat shock protein 90, respectively. Thus, the cytosolic localization of Oct-6 found here suggests the existence of a mode of regulation not previously anticipated for Oct-6 or the POU domain proteins in general. These considerations are important if we are to understand the consequences for the schizophrenic brain of this unexplained ectopic expression of Oct-6, whatever may ultimately prove to be its cause.

|
Footnotes
|
Received March 1, 2001; revisions received July 30, 2001, and Jan. 16, 2002; accepted Jan. 24, 2002. From the Departments of Neuroscience, Psychological Medicine and Neuropathology, and Clinical Neuropharmacology, Institute of Psychiatry, Kings College London; and the Department of Cell Biology and Genetics, Erasmus University Rotterdam, Rotterdam, the Netherlands. Address reprint requests to Dr. Price, Department of Neuroscience, Institute of Psychiatry, 1 Windsor Walk, Denmark Hill, London SE5 8AF, U.K.; j.price{at}iop.kcl.ac.uk (e-mail). Supported by the European Commission, the Medical Research Council, the Biotechnology and Biological Sciences Research Council, and the Netherlands national research council (NWO). The authors thank Professor Robin Murray for comments on the manuscript, Nadeem Khan for assistance with tissue collection, and Vicky Amoah for secretarial assistance.

|
References
|
- Murray RM, OCallaghan E, Castle DJ, Lewis SW: A neurodevelopmental approach to the classification of schizophrenia. Schizophr Bull 1992; 18:319-332
- Mayada A, Weinberger DR: Neuropathology and neurodevelopmental model, in Neuropathology of Schizophrenia: Progress and Interpretation. Edited by Harrison PJ, Roberts GW. Oxford, UK, Oxford University Press, 2000, pp 189-212
- Pearlson GD, Marsh L: Structural brain imaging in schizophrenia: a selective review. Biol Psychiatry 1999; 46:627-649[CrossRef][Medline]
- Akbarian S, Kim JJ, Potkin SG, Hetrick WP, Bunney WE, Jones EG: Maldistribution of interstitial neurons in prefrontal white matter of the brains of schizophrenic patients. Arch Gen Psychiatry 1996; 53:425-436[Abstract]
- Jakob H, Beckmann H: Prenatal developmental disturbances in the limbic allocortex in schizophrenics. J Neural Transm 1986; 65:303-326
- Roberts GW, Colter N, Lofthouse R, Johnstone EC, Crow TJ: Is there gliosis in schizophrenia? investigation of the temporal lobe. Biol Psychiatry 1987; 22:1459-1468[CrossRef][Medline]
- Monuki ES, Kuhn R, Weinmaster G, Trapp BD, Lemke G: Expression and activity of the POU transcription factor SCIP. Science 1990; 249:1300-1303[Abstract/Free Full Text]
- Suzuki N, Rohdewohld H, Neuman T, Gruss P, Scholer HR: Oct-6: a POU transcription factor expressed in embryonal stem cells and in the developing brain. EMBO J 1990; 9:3723-3732[Medline]
- Witta SE, Sato SM: XIPOU 2 is a potential regulator of Spemanns Organizer. Development 1997; 124:1179-1189[Abstract]
- Bhat KM, Schedl P: The Drosophila miti-mere gene, a member of the POU family, is required for the specification of the RP2/sibling lineage during neurogenesis. Development 1994; 120:1483-1501[Abstract]
- Ruvkun G, Finney M: Regulation of transcription and cell identity by POU domain proteins. Cell 1991; 64:475-478[CrossRef][Medline]
- Meijer D, Graus A, Kraay R, Langeveld A, Mulder MP, Grosveld G: The octamer binding factor Oct6: cDNA cloning and expression in early embryonic cells. Nucleic Acids Res 1990; 18:7357-7365[Abstract/Free Full Text]
- Jaegle M, Mandemakers W, Broos L, Zwart R, Karis A, Visser P, Grosveld F, Meijer D: The POU factor Oct-6 and Schwann cell differentiation. Science 1996; 273:507-510[Abstract]
- Bermingham JRJ, Scherer SS, OConnell S, Arroyo E, Kalla KA, Powell FL, Rosenfeld MG: Tst-1/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration. Genes Dev 1996; 10:1751-1762[Abstract/Free Full Text]
- Frantz GD, Bohner AP, Akers RM, McConnell SK: Regulation of the POU domain gene SCIP during cerebral cortical development. J Neurosci 1994; 14:472-485[Abstract]
- Sambrook J, Russell DW: Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press, 2001
- Mandemakers W, Zwart R, Jaegle M, Walbeehm E, Visser P, Grosveld F, Meijer D: A distal Schwann cell-specific enhancer mediates axonal regulation of the Oct-6 transcription factor during peripheral nerve development and regeneration. EMBO J 2000; 19:2992-3003[CrossRef][Medline]
- Tobler A, Schreiber E, Fontana A: The human Oct-6 POU transcription factor lacks the first 50 amino acids of its murine counterpart. Nucleic Acids Res 1993; 21:1043[Free Full Text]
- He X, Treacy M, Simmons D, Ingraham H, Swanson L, Rosenfeld M: Expression of a larger family of POU-domain regulatory genes in mammalian brain development. Nature 1989; 340:35-42[CrossRef][Medline]
- Peeper DS, Schouten GJ, Toebes M, Meijer D, Zwart R, van de Woude I, van Schaik H, van der Eb AJ, Zantema A: Induction of differentiation-regulated transcription factor Oct-6 specifically accompanies major histocompatibility complex class I down-regulation by E1A of oncogenic adenovirus type 12. Cell Growth Differ 1995; 6:977-984[Abstract]
- Arroyo EJ, Bermingham JRJ, Rosenfeld MG, Scherer SS: Promyelinating Schwann cells express Tst-1/SCIP/Oct-6. J Neurosci 1998; 18:7891-7902[Abstract/Free Full Text]
- Scherer SS, Wang DY, Kuhn R, Lemke G, Wrabetz L KJ: Axons regulate Schwann cell expression of the POU transcription factor SCIP. J Neurosci 1994; 14:1930-1942[Abstract]
- Zorick TS, Syroid DE, Arroyo E, Scherer SS, Lemke G: The transcription factors SCIP and Krox-20 mark distinct stages and cell fates in Schwann cell differentiation. Mol Cell Neurosci 1996; 8:129-145[CrossRef][Medline]
- Cotter D, Kerwin R, al-Sarraji S, Brion JP, Chadwich A, Lovestone S, Anderton B, Everall I: Abnormalities of Wnt signalling in schizophreniaevidence for neurodevelopmental abnormality. Neuroreport 1998; 9:1379-1383[Medline]
- Beasley C, Cotter D, Khan N, Pollard C, Sheppard P, Varndell I, Lovestone S, Anderton B, Everall I: Glycogen synthase kinase-3beta immunoreactivity is reduced in the prefrontal cortex in schizophrenia. Neurosci Lett 2001; 302:117-120[CrossRef][Medline]
- Harrison PJ: The neuropathology of schizophrenia: a critical review of the data and their interpretation. Brain 1999; 122:593-624[Abstract/Free Full Text]
- Monuki ES, Weinmaster G, Kuhn R, Lemke G: SCIP: a glial POU domain gene regulated by cyclic AMP. Neuron 1989; 3:783-793[CrossRef][Medline]
- Renner K, Sock E, Bermingham JRJ, Wegner M: Expression of the gene for the POU domain transcription factor Tst-1/Oct6 is regulated by an estrogen-dependent enhancer. Nucleic Acids Res 1996; 24:4552-4557[Abstract/Free Full Text]
- Alvarez-Bolado G, Rosenfeld MG, Swanson LW: Model of forebrain regionalization based on spatiotemporal patterns of POU-III homeobox gene expression, birthdates, and morphological features. J Comp Neurol 1995; 355:237-295[CrossRef][Medline]
- Liu Q, Melnikova IN, Hu M, Gardner PD: Cell type-specific activation of neuronal nicotinic acetylcholine receptor subunit genes by Sox10. J Neurosci 1999; 19:9747-9755[Abstract/Free Full Text]
- Yang X, McDonough J, Fyodorov D, Morris M, Wang F, Deneris ES: Characterization of an acetylcholine receptor alpha 3 gene promoter and its activation by the POU domain factor SCIP/Tst-1. J Biol Chem 1994; 269:10252-10264[Abstract/Free Full Text]
- Lewis SW, Murray RM: Obstetric complications, neurodevelopmental deviance, and risk of schizophrenia. J Psychiatr Res 1987; 21:413-421[CrossRef][Medline]
- Arnold SE, Trojanowski JQ: Recent advances in defining the neuropathology of schizophrenia. Acta Neuropathol (Berl) 1996; 92:217-231[CrossRef][Medline]
- Akbarian S, Bunney WE Jr, Potkin SG, Wigal SB, Hagman JO, Sandman CA, Jones EG: Altered distribution of nicotinamide-adenine dinucleotide phosphate-diaphorase cells in frontal lobe of schizophrenics implies disturbances of cortical development. Arch Gen Psychiatry 1993; 50:169-177[Abstract]
- Cotter D, Wilson S, Roberts E, Kerwin R, Everall IP: Increased dendritic MAP2 expression in the hippocampus in schizophrenia. Schizophr Res 2000; 41:313-323[CrossRef][Medline]
- Sock E, Enderich J, Rosenfeld MG, Wegner M: Identification of the nuclear localization signal of the POU domain protein Tst-1/Oct6. J Biol Chem 1996; 271:17512-17518[Abstract/Free Full Text]
- Baeuerle P, Baltimore D: NF-kappa B: ten years after. Cell 2002; 87:13-20
This article has been cited by other articles:

|
 |

|
 |
 
M. Jaegle, M. Ghazvini, W. Mandemakers, M. Piirsoo, S. Driegen, F. Levavasseur, S. Raghoenath, F. Grosveld, and D. Meijer
The POU proteins Brn-2 and Oct-6 share important functions in Schwann cell development
Genes & Dev.,
June 1, 2003;
17(11):
1380 - 1391.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Get information about faster international access.
a>
Privacy Policy
Copyright © 2002
American Psychiatric Association.
All rights reserved.
Home
| Search
| Current Issue
| Past Issues
| Subscribe
| All APPI Journals
| Help
| Contact Us
|