
Am J Psychiatry 159:652-654, April 2002
© 2002 American Psychiatric Association
A Functional Polymorphism in the COMT Gene and Performance on a Test of Prefrontal Cognition
Anil K. Malhotra, M.D.,
Lisa J. Kestler, B.S.,
Chiara Mazzanti, Ph.D.,
John A. Bates, Ph.D.,
Terry Goldberg, Ph.D., and
David Goldman, M.D.

|
Abstract
|
OBJECTIVE: In the prefrontal cortex, the enzyme catechol O-methyltransferase (COMT) is critical in the metabolic degradation of dopamine, a neurotransmitter hypothesized to influence human cognitive function. The COMT gene contains a functional polymorphism, Val158Met, that exerts a fourfold effect on enzyme activity. The current study investigated whether prefrontal cognition varies with COMT genotype. METHOD: Val158Met was genotyped in 73 healthy volunteers. A task of prefrontal cognition, the Wisconsin Card Sorting Test, was also administered. RESULTS: Subjects with only the low-activity met allele made significantly fewer perseverative errors on the Wisconsin Card Sorting Test than did subjects with the val allele. CONCLUSIONS: These data are consistent with those of previous studies, suggesting that a functional genetic polymorphism may influence prefrontal cognition.

|
Introduction
|
Several lines of evidence suggest that the neurotransmitter dopamine plays an important role in human cognition. Computational modeling studies indicate that dysfunction in dopamine systems accounts for abnormal cognitive control in the prefrontal cortex (1). In laboratory animals, low transmission of dopamine in the prefrontal cortex is associated with impairments in cognitive performance (2), and in humans, pharmacological enhancement of dopaminergic activity can produce improvements in specific cognitive domains dependent on the integrity of the prefrontal cortex (3).
The major mechanism by which the synaptic activity of dopamine is terminated is reuptake, followed by metabolic degradation. Catechol O-methyltransferase (COMT) is the major mammalian enzyme involved in the metabolic degradation of released dopamine and accounts for more than 60% of the metabolic degradation of dopamine in the frontal cortex (4). It is therefore plausible that genetic factors that affect COMT function may significantly influence cognition through effects on dopaminergic function.
The COMT gene contains a functional polymorphism that codes for a substitution of methionine (met) for valine (val) at codon 158 (5). The met allele is thermolabile and has one-fourth the enzymatic activity of the val allele (5). Recently, Egan and colleagues (6) reported that subjects with the low-activity met allele performed better (i.e., had fewer perseverative errors) on a neurocognitive test, the Wisconsin Card Sorting Test (7), than subjects with the val allele. This relationship of genotype to cognitive performance was observed in three groups of subjects of European origin: healthy volunteers (N=55), schizophrenia patients (N=175), and the siblings of schizophrenia patients (N=219). The finding of a significant relationship between COMT genotype and cognitive function in healthy subjects requires replication. Therefore, in the present study we examined a cohort of healthy volunteers who took the Wisconsin Card Sorting Test and were genotyped at the COMT Val158Met locus to test the hypothesis that subjects with only the COMT met allele would perform better on the Wisconsin Card Sorting Test than subjects with the COMT val allele.

|
Method
|
The participants were 73 healthy volunteers, 42 men and 31 women, with a mean age of 31.3 years (SD=10.2). There were 49 Caucasians, 14 blacks, five Hispanics, three Asians, and two with mixed ethnicity. All provided written informed consent. All subjects were free of psychiatric disorders, as determined by a structured diagnostic interview, and in good physical health, as determined by physical examination, electrocardiogram, and laboratory tests including liver and thyroid function tests and urinalysis. All had been free of drug and alcohol abuse for at least 6 months.
The subjects were each assessed with the Wisconsin Card Sorting Test, a widely used measure of prefrontal cognitive function that is sensitive to a subjects ability to generate hypotheses, establish response sets, and fluently shift sets. Subjects are required to sort stimulus cards on the basis of perceptual attributes (color, form, number). The only feedback provided by the administrator is whether each response is correct or incorrect. The sorting rule is changed after 10 consecutive correct responses. Testing is discontinued when the subject has learned two iterations of the three sorting rules or has reached 128 trials (7). The primary outcome measure used for this study was the number of perseverative errors, a measure sensitive to an individuals ability to fluently shift cognitive sets and the measure used by Egan and colleagues (6).
COMT Val158Met genotypes were determined by restriction fragment length polymorphism. A 109-base-pair polymerase chain reaction (PCR) product was generated in 30 cycles with an annealing temperature of 54°C by using the primers Comt1 nt 1881 5' CTCATCACCATCGAGATCAA and Comt2 nt 1989 5' CCAGGTCTGACAACGGGTCA.
The val and met alleles were discriminated by digesting the PCR product with N1aIII at 37°C for 4 hours, followed by 4.5% agarose gel electrophoresis. The val/val homozygotes (86 and 23 base pairs), met/met homozygotes (68 and 18 base pairs), and val/met heterozygotes (86, 68, 23, and 18 base pairs) were visualized by ethidium bromide staining.
Welchs analysis of variance (ANOVA) was carried out with COMT genotype as the independent factor and number of perseverative errors as the dependent measure (8). This procedure was used because a test of the assumption of homogeneity of variance indicated that the variances within the groups were dissimilar (F=3.42, df=2, 70, p=0.04), and Welchs ANOVA is robust to such violations. A mixed-model analysis that fit separate variances for each group was then used to conduct paired comparisons.

|
Results
|
The results are displayed in Figure 1. There were 13 subjects with the met/met COMT genotype, 31 with the met/val genotype, and 29 with the val/val genotype, a distribution consistent with Hardy-Weinberg expectations ( 2=0.84, df=2, p=0.67). The mean number of categories completed by the 73 subjects was 5.48 (SD=1.28), and there was no significant difference (F=1.44, df=2, 70, p=0.25) between the three genotypic groups. The mean number of perseverative errors for the subjects with the met/met genotype was 7.46 (SD=4.01), for met/val it was 13.03 (SD=11.18), and for val/val it was 12.21 (SD=9.08). ANOVA revealed a significant relationship between COMT Val158Met genotype and the number of perseverative errors (F=4.43, df=2, 70, p=0.02). The met/met group committed significantly fewer perseverative errors than either the met/val group (t=2.43, df=70, p=0.02) or the val/val group (t=2.35, df=70, p=0.02). There was no significant difference between the performances of the met/val and val/val groups (t=0.31, df=70, p=0.75). No significant differences were observed between the three genotypic groups in age (F=0.03, df=2, 70, p=0.97), sex ( 2=4.67, df=2, p=0.10), or ethnicity (Fishers exact test, p=0.18).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 1. Perseverative Errors on the Wisconsin Card Sorting Test of Healthy Volunteers Categorized by Genotype at the Val158Met Locus of the Gene for Catechol O-Methyltransferase (COMT)a
a The horizontal lines represent mean values.
|

|
Discussion
|
The present study tested the relationship between COMT Val158Met genotype and performance on the Wisconsin Card Sorting Test in healthy subjects. Subjects with the met/met genotype performed significantly better than met/val and val/val subjects on the outcome variable, perseverative errors.
These data are consistent with the results of other studies examining the role of COMT in cognitive function. First, Egan and colleagues (6) recently reported that healthy subjects with the met allele produced fewer perseverative errors on the Wisconsin Card Sorting Test than subjects with the val allele. Moreover, COMT gene knockout mice display better memory than wild-type mice under conditions of environmental stress (9). Finally, clinical trials data (3) indicate that pharmacological inhibition of COMT function with the antiparkinsonian agent tolcapone improves cognitive performance. Taken together, these data provide evidence that reductions in COMT function, whether induced by a pharmacological agent, gene knockout, or the presence of a low-function allele, are associated with improved cognitive performance.
Several other factors should be considered in the interpretation of these data. Performance on the Wisconsin Card Sorting Test may vary among ethnic groups, and this result could reflect undetected ethnic differences between phenotypic groups. However, analysis of only the Caucasian subjects within the present data set revealed the same pattern of results seen in the larger group. Among the Caucasians, the met/met subjects produced 23% fewer perseverative errors (mean=7.58, SD=4.17) than the met/val subjects (mean=9.87, SD=9.43), and 17% fewer perseverative errors than the val/val subjects (mean=9.08, SD=6.47). These differences are smaller than the differences observed in the study group as a whole, which suggests that the effect of the COMT Val158Met polymorphism is stronger in some ethnic groups than in others. In addition, it should be noted that the study by Egan and colleagues (6) used Caucasian subjects of European origin, whereas the Caucasian subjects in our study were not classified by ancestral origin, so these data are not precisely comparable. Quantitative family-based association studies (10) or assessment of potential stratification with genomic control techniques (11) (when available for quantitative traits) will be helpful in resolving this issue in future studies. The COMT Val158Met polymorphism could be in linkage disequilibrium with another variant, and the associations between Val158Met and performance on the Wisconsin Card Sorting Test may reflect the influence of these other variants. However, the COMT gene has been extensively studied, and to our knowledge, no other functional variant in linkage disequilibrium with Val158Met has yet been identified (12). Indeed, we elected to test the only known functional polymorphism within the COMT gene, and therefore the polymorphism with the highest a priori probability of influencing a cognitive phenotype, rather than genotyping additional markers and diffusing the power of this study to detect a functional signal. If larger data sets become available, further study of this gene and performance on the Wisconsin Card Sorting Test may be warranted.
This association between the COMT Val158Met polymorphism and performance on a test of executive cognitive function is consistent with the findings in the study of this polymorphism by Egan et al. (6) and provide what we believe to be the first independent support for a role of COMT genotype on one aspect of prefrontal cognition.

|
Footnotes
|
Received April 26, 2001; revisions received July 17 and Sept. 17, 2001; accepted Sept. 25, 2001. From the Unit of Molecular Psychiatry, Hillside Hospital; and the Laboratory of Neurogenetics, National Institute on Alcohol Abuse and Alcoholism, Rockville, Md. Address reprint requests to Dr. Malhotra, Psychiatry Research, Hillside Hospital, 75-59 263rd St., Glen Oaks, NY 11004; malhotra{at}lij.edu (e-mail). Supported in part by NIMH grants MH-01760 and MH-60575. The authors thank Marjorie McMeniman, Ph.D., for assistance with statistical analysis of these data.

|
References
|
-
Braver TS, Barch DM, Cohen JD: Cognition and control in schizophrenia: a computational model of dopamine and prefrontal function. Biol Psychiatry 1999; 46:312-328[CrossRef][Medline]
-
Jentsch JD, Tran A, Le D, Youngren KD, Roth RH: Subchronic phencyclidine administration reduces mesoprefrontal dopamine utilization and impairs prefrontal cortical-dependent cognition in the rat. Neuropsychopharmacology 1997; 17:92-99[CrossRef][Medline]
-
Gasparini M, Fabrizio E, Bonifati V, Meco G: Cognitive improvement during tolcapone treatment in Parkinsons disease. J Neural Transm 1997; 104:887-894
-
Karoum F, Chrapusta SJ, Egan MF: 3-Methoxytyramine is the major metabolite of released dopamine in the rat frontal cortex: reassessment of the effects of antipsychotics on the dynamics of dopamine release and metabolism in the frontal cortex, nucleus accumbens, and striatum by a simple two pool model. J Neurochem 1994; 63:972-979[Medline]
-
Lachman HM, Papolos DF, Saito T, Yu YM, Szumlanski CL, Weinshilboum RM: Human catechol-O-methyltransferase pharmacogenetics: description of a functional polymorphism and its potential application to neuropsychiatric disorders. Pharmacogenetics 1996; 6:243-250[Medline]
-
Egan MF, Goldberg TE, Kolachana BS, Callicott JH, Mazzanti CM, Straub RE, Goldman D, Weinberger DR: Effect of COMT Val108/158 Met genotype on frontal lobe function and risk for schizophrenia. Proc Natl Acad Sci USA 2001; 98:6917-6922[Abstract/Free Full Text]
-
Heaton RK, Chelune GJ, Talley JL, Kay GG, Curtiss G: Wisconsin Card Sorting Test Manual. Odessa, Fla, Psychological Assessment Resources, 1993
-
Welch BL: On the comparison of several mean values: an alternative approach. Biometrika 1951; 38:330-336[Free Full Text]
-
Kneavel M, Gogos J, Karayiorgou K, Luine V: Interaction of COMT gene deletion and environment on cognition. Abstracts of the Society for Neuroscience 2000; 26:1535
-
Allison DB: Transmission-disequilibrium tests for quantitative traits. Am J Hum Genet 1997; 60:676-690[Medline]
-
Pritchard JK, Rosenberg NA: Use of unlinked genetic markers to detect population stratification in association studies. Am J Hum Genet 1999; 65:220-228[CrossRef][Medline]
-
Li T, Ball D, Zhao J, Murray RM, Liu X, Sham PC, Collier DA: Family-based linkage disequilibrium mapping using SNP marker haplotypes: application to a potential locus for schizophrenia at chromosome 22q11. Mol Psychiatry 2000; 5:77-84[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
E. Ivleva, G. Thaker, and C. A. Tamminga
Comparing Genes and Phenomenology in the Major Psychoses: Schizophrenia and Bipolar 1 Disorder
Schizophr Bull,
July 1, 2008;
34(4):
734 - 742.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Raz, U. Lindenberger, P. Ghisletta, K. M. Rodrigue, K. M. Kennedy, and J. D. Acker
Neuroanatomical Correlates of Fluid Intelligence in Healthy Adults and Persons with Vascular Risk Factors
Cereb Cortex,
March 1, 2008;
18(3):
718 - 726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Raymont, A. Greathouse, K. Reding, R. Lipsky, A. Salazar, and J. Grafman
Demographic, structural and genetic predictors of late cognitive decline after penetrating head injury
Brain,
February 1, 2008;
131(2):
543 - 558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. Williams-Gray, A. Hampshire, R. A. Barker, and A. M. Owen
Attentional control in Parkinson's disease is dependent on COMT val158met genotype
Brain,
February 1, 2008;
131(2):
397 - 408.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Opgen-Rhein, A. H. Neuhaus, C. Urbanek, E. Hahn, T. Sander, and M. Dettling
Executive Attention in Schizophrenic Males and the Impact of COMT Val108/158Met Genotype on Performance on the Attention Network Test
Schizophr Bull,
January 16, 2008;
(2008)
sbm155v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Diamond
Consequences of Variations in Genes that affect Dopamine in Prefrontal Cortex
Cereb Cortex,
September 1, 2007;
17(suppl_1):
i161 - i170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-Y. Tan, J. H. Callicott, and D. R. Weinberger
Dysfunctional and Compensatory Prefrontal Cortical Systems, Genes and the Pathogenesis of Schizophrenia
Cereb Cortex,
September 1, 2007;
17(suppl_1):
i171 - i181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. Williams-Gray, A. Hampshire, T. W. Robbins, A. M. Owen, and R. A. Barker
Catechol O-Methyltransferase val158met Genotype Influences Frontoparietal Activity during Planning in Patients with Parkinson's Disease
J. Neurosci.,
May 2, 2007;
27(18):
4832 - 4838.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Tunbridge, C. Weickert, J. Kleinman, M. Herman, J Chen, B. Kolachana, P. Harrison, and D. Weinberger
Catechol-o-Methyltransferase Enzyme Activity and Protein Expression in Human Prefrontal Cortex across the Postnatal Lifespan
Cereb Cortex,
May 1, 2007;
17(5):
1206 - 1212.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Reuter, U. Ott, D. Vaitl, and J. Hennig
Impaired executive control is associated with a variation in the promoter region of the tryptophan hydroxylase 2 gene.
J. Cogn. Neurosci.,
March 1, 2007;
19(3):
401 - 408.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Barnett, J. Heron, S. M. Ring, J. Golding, D. Goldman, K. Xu, and P. B. Jones
Gender-Specific Effects of the Catechol-O-Methyltransferase Val108/158Met Polymorphism on Cognitive Function in Children
Am J Psychiatry,
January 1, 2007;
164(1):
142 - 149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Raux, E. Bumsel, B. Hecketsweiler, T. van Amelsvoort, J. Zinkstok, S. Manouvrier-Hanu, C. Fantini, G.-M. M. Breviere, G. Di Rosa, G. Pustorino, et al.
Involvement of hyperprolinemia in cognitive and psychiatric features of the 22q11 deletion syndrome
Hum. Mol. Genet.,
January 1, 2007;
16(1):
83 - 91.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Goldman, G. Oroszi, and F. Ducci
The Genetics of Addictions: Uncovering the Genes
Focus,
August 1, 2006;
4(3):
401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. H. Fanous and K. S. Kendler
Genetic Heterogeneity, Modifier Genes, and Quantitative Phenotypes in Psychiatric Illness: Searching for a Framework
Focus,
August 1, 2006;
4(3):
423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Burdick, T. Lencz, B. Funke, C. T. Finn, P. R. Szeszko, J. M. Kane, R. Kucherlapati, and A. K. Malhotra
Genetic variation in DTNBP1 influences general cognitive ability
Hum. Mol. Genet.,
May 15, 2006;
15(10):
1563 - 1568.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Glaser, M. Debbane, C. Hinard, M. A. Morris, S. P. Dahoun, S. E. Antonarakis, and S. Eliez
No Evidence for an Effect of COMT Val158Met Genotype on Executive Function in Patients With 22q11 Deletion Syndrome
Am J Psychiatry,
March 1, 2006;
163(3):
537 - 539.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Craddock, M. C O'Donovan, and M. J Owen
Genes for Schizophrenia and Bipolar Disorder? Implications for Psychiatric Nosology
Schizophr Bull,
January 1, 2006;
32(1):
9 - 16.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Congdon and T. Canli
The endophenotype of impulsivity: reaching consilience through behavioral, genetic, and neuroimaging approaches.
Behav Cogn Neurosci Rev,
December 1, 2005;
4(4):
262 - 281.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Thapar, K. Langley, T. Fowler, F. Rice, D. Turic, N. Whittinger, J. Aggleton, M. Van den Bree, M. Owen, and M. O'Donovan
Catechol O-Methyltransferase Gene Variant and Birth Weight Predict Early-Onset Antisocial Behavior in Children With Attention-Deficit/Hyperactivity Disorder
Arch Gen Psychiatry,
November 1, 2005;
62(11):
1275 - 1278.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. H. Lipsky, M. B. Sparling, L. M. Ryan, K. Xu, A. M. Salazar, D. Goldman, and D. L. Warden
Association of COMT Val158Met Genotype With Executive Functioning Following Traumatic Brain Injury
J Neuropsychiatry Clin Neurosci,
November 1, 2005;
17(4):
465 - 471.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. de Frias, K. Annerbrink, L. Westberg, E. Eriksson, R. Adolfsson, and L.-G. Nilsson
Catechol O-Methyltransferase Val158Met Polymorphism is Associated with Cognitive Performance in Nondemented Adults
J. Cogn. Neurosci.,
July 1, 2005;
17(7):
1018 - 1025.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Blasi, V. S. Mattay, A. Bertolino, B. Elvevag, J. H. Callicott, S. Das, B. S. Kolachana, M. F. Egan, T. E. Goldberg, and D. R. Weinberger
Effect of Catechol-O-Methyltransferase val158met Genotype on Attentional Control
J. Neurosci.,
May 18, 2005;
25(20):
5038 - 5045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N Craddock, M C O'Donovan, and M J Owen
The genetics of schizophrenia and bipolar disorder: dissecting psychosis
J. Med. Genet.,
March 1, 2005;
42(3):
193 - 204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bertolino, G. Caforio, G. Blasi, M. De Candia, V. Latorre, V. Petruzzella, M. Altamura, G. Nappi, S. Papa, J. H. Callicott, et al.
Interaction of COMT Val108/158 Met Genotype and Olanzapine Treatment on Prefrontal Cortical Function in Patients With Schizophrenia
Am J Psychiatry,
October 1, 2004;
161(10):
1798 - 1805.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Bearden, A. F. Jawad, D. R. Lynch, S. Sokol, S. J. Kanes, D. M. McDonald-McGinn, S. C. Saitta, S. E. Harris, E. Moss, P. P. Wang, et al.
Effects of a Functional COMT Polymorphism on Prefrontal Cognitive Function in Patients With 22q11.2 Deletion Syndrome
Am J Psychiatry,
September 1, 2004;
161(9):
1700 - 1702.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rosa, V. Peralta, M. J. Cuesta, A. Zarzuela, F. Serrano, A. Martinez-Larrea, and L. Fananas
New Evidence of Association Between COMT Gene and Prefrontal Neurocognitive Function in Healthy Individuals From Sibling Pairs Discordant for Psychosis
Am J Psychiatry,
June 1, 2004;
161(6):
1110 - 1112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-L. Eriksson, S. Skrtic, A. Niklason, L. M. Hulten, O. Wiklund, T. Hedner, and C. Ohlsson
Association between the low activity genotype of catechol-O-methyltransferase and myocardial infarction in a hypertensive population
Eur. Heart J.,
March 1, 2004;
25(5):
386 - 391.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Nolan, R. M. Bilder, H. M. Lachman, and J. Volavka
Catechol O-Methyltransferase Val158Met Polymorphism in Schizophrenia: Differential Effects of Val and Met Alleles on Cognitive Stability and Flexibility
Am J Psychiatry,
February 1, 2004;
161(2):
359 - 361.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Diamond, L. Briand, J. Fossella, and L. Gehlbach
Genetic and Neurochemical Modulation of Prefrontal Cognitive Functions in Children
Am J Psychiatry,
January 1, 2004;
161(1):
125 - 132.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Langley, L. Marshall, M. van den Bree, H. Thomas, M. Owen, M. O'Donovan, and A. Thapar
Association of the Dopamine D4 Receptor Gene 7-Repeat Allele With Neuropsychological Test Performance of Children With ADHD
Am J Psychiatry,
January 1, 2004;
161(1):
133 - 138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Greenwood and R. Parasuraman
Normal Genetic Variation, Cognition, and Aging
Behav Cogn Neurosci Rev,
December 1, 2003;
2(4):
278 - 306.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. O'Donovan, N. M. Williams, and M. J. Owen
Recent advances in the genetics of schizophrenia
Hum. Mol. Genet.,
October 15, 2003;
12(90002):
R125 - 133.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. Goldberg, M. F. Egan, T. Gscheidle, R. Coppola, T. Weickert, B. S. Kolachana, D. Goldman, and D. R. Weinberger
Executive Subprocesses in Working Memory: Relationship to Catechol-O-methyltransferase Val158Met Genotype and Schizophrenia
Arch Gen Psychiatry,
September 1, 2003;
60(9):
889 - 896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. S. Mattay, T. E. Goldberg, F. Fera, A. R. Hariri, A. Tessitore, M. F. Egan, B. Kolachana, J. H. Callicott, and D. R. Weinberger
Catechol O-methyltransferase val158-met genotype and individual variation in the brain response to amphetamine
PNAS,
May 13, 2003;
100(10):
6186 - 6191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wedren, T. R. Rudqvist, F. Granath, E. Weiderpass, M. Ingelman-Sundberg, I. Persson, and C. Magnusson
Catechol-O-methyltransferase gene polymorphism and post-menopausal breast cancer risk
Carcinogenesis,
April 1, 2003;
24(4):
681 - 687.
[Abstract]
[Full Text]
| |