Schizophrenia is a brain disease whose etiology is largely unknown, but one current hypothesis is that the origins of the disorder lie early in life, possibly during prenatal brain development (1). This "neurodevelopmental hypothesis" suggests that a brain abnormality is present early in life but does not fully manifest itself clinically until late adolescence or early adulthood (2). This hypothesis has grown from studies of the neuropathology and epidemiology of the disease and has been supported by more recent imaging studies. These latter studies have demonstrated an enlargement of the cerebral ventricles in schizophrenic patients as well as structural abnormalities in the frontal and temporal lobes (3). These findings agree, in general, with neuropathological reports of temporal and frontal lobe abnormalities of the schizophrenic brain. Pathological studies also indicate that subtle abnormalities of cortical development may be present (4, 5). The findings of cytoarchitectural abnormalities, along with a lack of gliosis (6), have been taken as evidence that schizophrenia is a developmental disorder. Nonetheless, the pathological findings have been distinguished mostly by their variability and by the subtlety of the changes observed in schizophrenic patients in the markers that have been described. While the developmental processes implicated by this evidence have yet to be defined, speculation has centered on abnormalities of neuronal proliferation and migration and abnormalities of the formation of neuronal connections. There is little understanding, however, of the mechanism by which normal brain development might be disturbed.
Our approach to understanding schizophrenia pathology has been to consider the genes that regulate normal brain development. One such group of genes is the POU family of homeobox transcription factors. Members of this family are expressed in the nervous systems of a wide range of vertebrate and invertebrate species (7–10). We have studied expression of the Oct-6 gene (also known as SCIP and Tst-1), a POU-III subfamily member (11). Oct-6 also appears to have a predominantly developmental role, being expressed in embryonic stem cells and in the mouse inner cell mass (8, 12), but its best characterized role is in Schwann cell development in the peripheral nervous system, where it regulates the timely onset of myelination (13, 14).
In the developing rodent telencephalon, Oct-6 expression is turned on as neurons become postmitotic and migrate to their final positions in the cortical plate, the embryonic cortical gray matter (15). This means that Oct-6 is expressed during the period in which neurons first begin to establish their neuronal identity and axonal projection and in which they find their definitive cortical layer. In the postnatal brain, Oct-6 expression is mostly lost, but it is retained by certain specific subpopulations of neurons in layers 5 and 2/3 of the cerebral cortex and in the CA1 field of the hippocampus (15). The role of Oct-6 in neuronal development is unknown, but the timing of its expression suggests that it may play a role in establishing neuronal subtype identity and pattern of axonal projection.
In this study, we examined the pattern of expression of Oct-6 by studying immunoreactivity to the Oct-6 protein in the cortex of schizophrenic patients. We show that Oct-6 is widely expressed in the temporal and frontal lobe of schizophrenic specimens, while it is essentially undetectable in matched comparison specimens.
Samples were obtained from the Medical Research Council Brain Bank, Institute of Psychiatry, King’s College London. Demographic characteristics of the schizophrenic subjects and the comparison subjects are described in t1, t2, and t3. There were no significant differences in age, gender, or postmortem interval between groups. Exclusion criteria included any disorders related to the central nervous system, such as head injury, alcohol dependence, or Alzheimer’s disease. Tissue was obtained from patients with a clinical diagnosis of schizophrenia according to DSM-III-R criteria. The mean amount of neuroleptic exposure in the month before death was estimated for the schizophrenic subjects (t1 and t2) and expressed in chlorpromazine equivalents. There was no information on chlorpromazine equivalents values for the 10 schizophrenic specimens presented in t3.
+
Oct-6 Antiserum Generation
To obtain antibodies specific to Oct-6, we immunized rabbits with bacterially overexpressed and purified Oct-61–196 protein (12). For expression in bacteria of the amino-terminal portion (amino acids 1 through 196) of the Oct-6 protein, we cloned a 587 BalI-PvuII restriction fragment in frame into the pQE9 bacterial expression cassette (Qiagen, Crawley, U.K.). This allowed the use of isopropyl-beta-d-thiogalactopyranoside (IPTG) to induce overexpression of the hexa-histidine (His6)-tagged Oct-61–196 peptide in bacteria (M15[prep4]) (Qiagen) from an E. coli phage T5 promoter. Briefly, an overnight bacterial culture was pelleted and sonicated in 10 ml of 6M urea in phosphate-buffered solution (PBS). The cell lysate was cleared by centrifugation and brought to 0.8 mM imidazole, after which 300 μl of slurry nickel-nitrilotriacetate (Ni-NTA) agarose beads (Qiagen) was added. The His6-tagged Oct-6 peptide was allowed to bind to the Ni-NTA beads by incubating the mixture of lysate and Ni-NTA slurry overnight. The Oct-6 peptide was eluted from the Ni-NTA beads in 500μl of 6M urea in the mixture of PBS and 80 mM imidazole. This purification procedure resulted in high yields of pure (>95%) and intact Oct-61–196 peptide, as judged by Coomassie-stained sodium dodecyl sulfate polyacrylamide gels. Antibodies were raised in White New Zealand rabbits with four consecutive injections at 4-week intervals of 0.5–1.0 mg Oct-61–169 peptide resuspended in incomplete Freund’s adjuvant. Oct-6 immunoreactivity and specificity of the sera (number 1894, boost 4) were tested in Western blotting, immunohistochemistry, and electrophoretic mobility shift experiments.
COS-1 cells were grown in Dulbecco’s modified Eagle’s medium or Ham’s F10 medium supplemented with 5% fetal calf serum, penicillin, and streptomycin. Cells were transfected by using the diethylaminoethyl (DEAE)-dextran method (16). The day preceding transfection 500,000 cells were plated on a 10-cm tissue culture dish. The next day the cells were transfected with 10 μg of plasmid DNA (cytomegalovirus-Oct-6 or cytomegalovirus-Krox-20 expression vectors) and 100 μg/ml of DEAE-dextran (Amersham Pharmacia Biotech, Little Chalfont, U.K.). After 2 hours the transfection medium was removed and replaced by a serum-free medium containing 0.1 mM of chloroquine (Sigma, St. Louis). Two days later cells were harvested and further processed for electrophoretic mobility shift assay and Western blotting analysis (12).
+
Whole-Cell Extracts and Electrophoretic Mobility Shift Assay
Whole-cell extracts of adenovirus-12-E1A-transformed mouse kidney cells were prepared by subjecting the cells to four cycles of freezing in liquid nitrogen and thawing on ice. The cellular debris was removed by centrifugation, and the supernatant was snap-frozen in liquid nitrogen and stored at –80˚C or used immediately. Equal amounts of cellular extract were used in an electrophoretic mobility shift assay by using 3 fmol of a 32P end-labeled double stranded DNA probe (GAGAGGAATTTGCATTTCCACCGACCTTCC). Probe and protein were incubated on ice for 20 minutes in 20 mM of Hepes potassium hydroxide (pH 7.9), 1 mM EDTA, 1 mM ethylene glycol bis(beta-aminoethyl ether)-NN′-tetraacetic acid, and 4% Ficoll in a total volume of 20 ml. These incubations were done in the presence of 1 μl of crude Oct-6, Brn-1, or preimmune serum. Protein DNA complexes were separated on a native 4% polyacrylamide gel in 0.25 × Tris-borate buffer and visualized by exposure to an X-ray film.
+
Tissue Processing and Immunohistochemistry
Blocks of temporal lobe were taken at the level of the lateral geniculate body and included the parahippocampal gyrus and hippocampus. All blocks used for immunohistochemistry were fixed in 10% formalin and subsequently coronally sliced before being embedded in paraffin wax. Seven-μm thick sections were stained by using standard immunohistochemical procedures to reveal the presence and location of Oct-6. Briefly, sections were dewaxed, rehydrated in methanol, and pretreated with 1% H2O2 for 30 minutes. Sections were then microwaved at 800 W for 8 minutes in a 0.001% solution of citric acid and phosphate buffer (pH 6.0). After being subjected to extensive washes with Tris-buffered saline, the sections were blocked with normal swine serum (Dako, Ltd., Ely, U.K.) and then incubated in the primary rabbit polyclonal anti-Oct-6 (1:250) antibody in Tris-buffered saline overnight at 4°C. The Oct-6 polyclonal antiserum used in this study was raised against the N-terminal region of Oct-6, a region of least homology with other POU proteins such as Oct-1, Oct-3, Oct-4, Brn-1, Brn-3, and Brn-4 (17). The coding sequence of the Oct-6 gene has 99% identity between the human (18), mouse (8, 12), and rat sequences (7, 19). Therefore, the antibody can be used to detect human Oct-6 protein in immunohistochemical applications. Finally a three-step avidin-biotin-horseradish peroxidase complex system was used (Dako, Ltd.), and the antibody was visualized by using the chromogen diaminobenzidine (Vector, Peterborough, U.K.). Duplicate sections of adjacent tissue in which the primary antibody was replaced by Tris-buffered saline were processed in parallel and were used as negative comparison tissue. All sections were analyzed with a Nikon light microscope with image analysis software (Lucia 4.0) (Kingston Upon Thames, U.K.).
Protein extracts were prepared from the temporal and frontal lobes of three schizophrenic and three comparison subjects. Protein samples were also extracted from the frontal lobe of 10 additional schizophrenic specimens and 10 additional matched comparison specimens. Each extract was lysed by the addition of 1% Nonidet P-40 lysis buffer plus protease inhibitors (2 μg of pepstatin per ml, 2 μg of leupeptin per ml, and 1 μg of peprotonin per ml) and vortexing. Solubilized samples were then centrifuged at 13,000 rpm at 4°C for 10 minutes. The protein concentration from each extract was estimated by performing a DC protein assay (Bio-Rad, Hemel Hempstead, U.K.). The solubilized lysates were then diluted to allow 2 μg (for Oct-6) and 0.5 μg (for β-catenin) of total protein to be loaded per lane. Optimization experiments showed that these amounts were within the linear range of detection. After protein quantification, samples were solubilized in standard sodium dodecyl sulfate sample buffer, denatured, and run on 10% Tris-polyacrylamide gels (Bio-Rad). The proteins were then transferred to 0.2 μm nitrocellulose paper (Sigma) by using a semidry blotting apparatus (Bio-Rad) and run at 10 V for 30 minutes. The blots were blocked with 10% casein solution (Sigma) for 30 minutes, and they were then treated with the avidin-biotin complex method according to the manufacturer’s instructions (Sigma). Next the membranes were incubated with either primary polyclonal antibody against Oct-6 (1:3,500) or a mouse polyclonal against β-catenin (1:10,000) (BD Biosciences Transduction Labs, Lexington, Kent.) for 30 minutes. Blots were then incubated with secondary biotinylated goat antirabbit antibody (Vector) for 30 minutes. Finally, a Vectastain ABC complex system (Vector) was used, and the blots were treated with the chromogen diaminobenzidine (Vector) until bands could be clearly seen. Negative comparison blots consisted of duplicate blots that were processed in parallel in which the primary antibody was replaced by Tris-buffered saline-T.
A polyclonal antiserum was raised in rabbits against the amino-terminal portion (amino acids 2 through 196) of the mouse Oct-6 protein, which is 98% identical to the Oct-6 proteins in the rat and in humans (7, 18, 19). This sequence was chosen because it is unique to Oct-6 and is not shared even by related POU-III domain proteins. The specificity of the antibody was demonstrated in three ways. First, the Oct-6 antibody specifically recognized a 45-kDa band in whole-cell extracts of COS cells transfected with an Oct-6 expression cassette (F1, top part), while no such band was detected in whole-cell extracts of COS cells transfected with an expression cassette for Krox-20, an unrelated transcription factor (column 2 in the top part of F1). Thus, cells engineered to carry the Oct-6 gene express a protein that specifically reacts with the anti-Oct-6 antibody. Second, specificity was demonstrated in an electrophoretic mobility shift assay. In this assay, mouse kidney cells transformed by the adenovirus E1A region expressed three POU proteins that bind with high affinity to the octamer sequence ATTTGCAT (20). These proteins are Oct-1, Oct-6, and Brn-1 (F1, bottom part). Addition of Oct-6 polyclonal antiserum abolished the formation of an Oct-6–DNA complex but did not affect the formation of the Oct-1– and Brn-1–DNA complexes in the same extract (F1, bottom part). Similarly, a Brn-1-specific antibody only affects the Brn-1–DNA complex and not the Oct-1 and Oct-6 complex (F1, bottom part). Thus, the Oct-6 antiserum specifically binds the Oct-6 protein but not the closely related Brn-1 protein or the more distantly related Oct-1 protein. Third, the antibody specifically recognized a band of the appropriate molecular weight in Western blots of extracts of tissue in which Oct-6 is expressed. This specific band can be seen in sciatic nerve extracts of young mouse pups (F1, top part) at a time in development when the expression of Oct-6 in Schwann cells of the developing peripheral nerve is well documented (13, 14, 21–23).
Thus, we have defined the specificity of the anti-Oct-6 antibody by three criteria:
1. Cells transfected with Oct-6 cDNA react with a single protein of appropriate electrophoretic mobility, while control transfected cells do not.
2. Tissue expressing endogenous Oct-6 shows a similar immunoreactive protein by Western blot.
3. The antibody specifically blocks the binding of Oct-6 to its cognate octamer binding sequence.
+
Immunohistochemical Staining
We used the anti-Oct-6 antibody to stain sections of comparison brain immunohistochemically. Sections from the hippocampal region of 10 comparison subjects (t1) failed to show any staining (F2, panel B). This region included the CA1 field of the hippocampus and layer V of the neocortex, areas where Oct-6 mRNA has been reported in young adult rodent brain. When we stained sections of the hippocampus from schizophrenic brains, however, we observed a considerable degree of Oct-6 immunoreactivity. Oct-6 was seen in a subset of cells in the pyramidal cell layer across the hippocampal formation, with no or very little staining in the adjoining strata oriens and radiatum (F2, panels D and F). The morphology of these cells suggested that they were indeed pyramidal neurons. Staining was marginal in the CA1 field, with few cells showing Oct-6 immunoreactivity (data not shown), but in the CA2, CA3, and CA4 fields a clear subset of pyramidal neurons were immunoreactive (F2, panels F, D, and C). Staining indicating Oct-6 immunoreactivity was also seen in a subset of neurons in the granule cell layer of the dentate gyrus (F2, panel E). This Oct-6 staining was widely expressed in the hippocampus of all 10 schizophrenic specimens (F2, panel C), in dramatic contrast with the comparison specimens (F2, panel B).
Higher power microscopy revealed that the Oct-6 staining was predominantly localized in the cytoplasm of the pyramidal cells, with little evidence of nuclear staining (F2, panel G). In the granule cell layer, cells appeared to be stained both in the cytoplasm and the nucleus (data not shown).
Protein levels of Oct-6 were examined in extracts from the frontal and temporal cortex of three schizophrenic and three matched comparison subjects. Immunoblots confirmed that the Oct-6 antibody recognized a single protein of about 45 kDa, as expected (8) (F3). There were high levels of Oct-6 in the frontal and temporal lobe of the schizophrenic specimens, while there was no or very little Oct-6 expression in the same regions of the matched comparison specimens (F3).
To ensure that there was no systematic error in the processing of the schizophrenic tissue versus the comparison tissue, Western blotting for β-catenin, a protein previously linked with schizophrenia, was performed for the three schizophrenic and three comparison specimens described in the previous paragraph (24). Immunostaining of blots revealed bands for β-catenin at 92 kDa in both the schizophrenic and the comparison groups (F3).
To increase the number of schizophrenic specimens, we studied Oct-6 expression in samples from the frontal lobe from 10 additional schizophrenic subjects and 10 additional matched comparison subjects. Immunoblots revealed high levels of Oct-6 in the frontal lobe of eight of the 10 schizophrenic specimens, while there was no or very little Oct-6 expression in the matched comparison subjects (F3).
This study demonstrated that extensive Oct-6 immunoreactivity is present in the frontal and temporal lobes of schizophrenic specimens, while there is limited expression of Oct-6 in matched comparison specimens. That this immunoreactivity is genuinely related to Oct-6 was confirmed by three sets of findings. First, COS cells transfected with a full-length Oct-6 cDNA expressed a band that comigrates with the native band in the nervous system. Second, electrophoretic mobility shift assay indicated that the Oct-6 antibody reacts with the Oct-6 protein and not with the related proteins Oct-1 or Brn-1. Finally, Western blots indicated that in tissue expressing Oct-6, the antibody recognizes a single band with the expected electrophoretic mobility in protein gels. The specific band of apparent molecular weight of 45 kDa was observed in tissue from the frontal and temporal lobes of the three schizophrenic subjects included in the histochemical analysis for which fresh-frozen material was available, but not in tissue from three of the matched comparison subjects. Immunoreactivity for β-catenin in all of these samples was similar. This protein has previously been shown to be expressed at similar levels in schizophrenic and comparison brains (25), so we take this finding as evidence that the difference in Oct-6 immunoreactivity between the schizophrenic and the comparison subjects could not be explained by trivial differences in the degree of protein deterioration between the samples. Oct-6 Western blot analysis was also performed on 10 additional schizophrenic and 10 additional comparison specimens for which fresh-frozen material was available. Eight of the ten schizophrenic specimens but none of the comparison specimens showed immunoreactivity. These data appear to indicate unequivocally that Oct-6 is expressed at greater levels in schizophrenic versus comparison brains. To our knowledge, this is the first reported example of a transcription factor being differentially expressed in schizophrenic versus comparison brains. We also believe this study reports the only example of a protein that is undetectable in comparison brains and is so demonstrably expressed in schizophrenic tissue. Other examples of differential expression have, of course, been demonstrated, but these have been relatively subtle quantitative changes (see reference 26 for discussion).
Our findings are significant in two regards. First, they indicate that Oct-6 may be useful as a neuropathological marker in schizophrenia. This disorder has been linked with numerous pathologies such as enlarged lateral ventricles and changes in the cellular architecture and circuitry in the frontal and temporal lobes of the cerebral cortex. Nonetheless, there is not yet any single pathophysiological marker that unequivocally distinguishes schizophrenic from normal tissue. Our data suggest that Oct-6 is worthy of further evaluation in this regard. Second, our findings might be a clue to the neurodevelopmental etiology of schizophrenia. In rodents, Oct-6 is broadly expressed only during development (as discussed later in this section). Assuming this is also true in humans, our data have two possible interpretations: either Oct-6 expression was never lost in individuals who were to go on to develop the disease or Oct-6 was subsequently up-regulated before or after the onset of the disease. These alternatives will be difficult to distinguish in human patients, but animal studies may be able to cast light on the factors that may prolong or reactivate Oct-6 expression and that may therefore have a role in the expression in schizophrenia. We know that in developing systems, Oct-6 is sensitive to factors that raise intracellular cAMP (27) and to estradiol (28), but these factors have no obvious link to schizophrenia.
A third possibility that needs to be considered is whether Oct-6 could be turned on in the schizophrenic subjects as a result of antipsychotic medication. Our evidence suggests that this is not the explanation. Chlorpromazine equivalents values in the month before death varied from 0 to 4000 across the schizophrenic group, yet we observed no difference in Oct-6 expression between schizophrenic subjects. This indicates that Oct-6 expression does not vary with exposure to neuroleptic treatment and suggests that medication is unlikely to be the cause of Oct-6 expression.
The predominant role of Oct-6 is believed to be developmental. It is expressed in embryonic stem cells and the mouse inner cell mass (8, 12). As development progresses, Oct-6 is expressed in the embryonic telencephalon, but it is down-regulated during early postnatal development so that expression in the young adult is maintained only in layer 5 and some supragranular neurons of the cerebral cortex and in the CA1 region of the hippocampus (15, 29). Our preliminary data indicate that expression continues to fall with age (unpublished observations) and becomes undetectable in older adult rodents as in the comparison human specimens in our study. Oct-6 is known to activate certain neurotransmitter receptors such as the nicotinic acetylcholine receptor subunit (30) and the acetylcholine α3 receptor (31). It is expressed during the phase of neuronal migration, fate determination, and axonal outgrowth. Nonetheless, the role of Oct-6 in neuronal development is poorly understood. Schizophrenia, on the other hand, has been linked with many developmental brain abnormalities such as faulty neuronal migration (32, 33), altered spatial neuronal arrangement (4, 34), and the absence of significant gliosis (33). It is plausible, therefore, that Oct-6 may play a role in the mechanism that is responsible for these developmental changes in schizophrenia.
Oct-6 staining was predominantly seen in the cytoplasm of neurons in the pyramidal cell layer of the hippocampus and in the dentate granule cell layer of the dentate gyrus. In the temporal lobe of schizophrenic specimens, Oct-6 staining was more prominent in the CA2, CA3, and CA4 regions and in the granule cell layer of the dentate gyrus than in the CA1 region. This finding suggests that Oct-6 may be associated with the changes in neuronal subpopulations and circuitry that are known to occur in schizophrenia. In support of this, it has been reported that MAP-2 (microtubule-associated protein) immunoreactive dendritic length is greater in the CA1, CA4, and subicular regions in schizophrenic specimens (35). This finding was based on the same schizophrenic samples as those used in the current study. The cytosolic localization of Oct-6 in schizophrenic brain is interesting because, under nonpathological conditions, Oct-6 is predominantly found in the nucleus, in line with its role as a transcription factor. Oct-6 is normally sequestered to the nucleus because of a nuclear localization sequence in the POU domain of the protein (36). Cytoplasmic Oct-6 could be the result of the breakdown of the nuclear transport or retention machinery in these cells. Alternatively Oct-6 protein could be sequestered in the cytoplasm through specific interactions with other proteins (37), as occurs with nuclear factor kappa B and glucocorticoid receptor transcription factors. These proteins are retained in the cytoplasm through complex formation with inhibitory kappa B or heat shock protein 90, respectively. Thus, the cytosolic localization of Oct-6 found here suggests the existence of a mode of regulation not previously anticipated for Oct-6 or the POU domain proteins in general. These considerations are important if we are to understand the consequences for the schizophrenic brain of this unexplained ectopic expression of Oct-6, whatever may ultimately prove to be its cause.
Received March 1, 2001; revisions received July 30, 2001, and Jan. 16, 2002; accepted Jan. 24, 2002. From the Departments of Neuroscience, Psychological Medicine and Neuropathology, and Clinical Neuropharmacology, Institute of Psychiatry, King’s College London; and the Department of Cell Biology and Genetics, Erasmus University Rotterdam, Rotterdam, the Netherlands. Address reprint requests to Dr. Price, Department of Neuroscience, Institute of Psychiatry, 1 Windsor Walk, Denmark Hill, London SE5 8AF, U.K.; j.price@iop.kcl.ac.uk (e-mail). Supported by the European Commission, the Medical Research Council, the Biotechnology and Biological Sciences Research Council, and the Netherlands national research council (NWO). The authors thank Professor Robin Murray for comments on the manuscript, Nadeem Khan for assistance with tissue collection, and Vicky Amoah for secretarial assistance.